First Report of Fusarium solani Causing Fusarium Root Rot and Stem Canker on Storage Roots of Sweet Potato in China.

Clicks: 261
ID: 83920
2014
Article Quality & Performance Metrics
Overall Quality Improving Quality
0.0 /100
Combines engagement data with AI-assessed academic quality
AI Quality Assessment
Not analyzed
Abstract
China is the biggest sweet potato (Ipomoea batatas (L.) Lam) producer in the world and its total production is about 100 million tons per year. Surveys for diseases of sweet potato in storage were conducted from 2011 to 2013 in Hebei Province, China. The storage roots from cultivars such as Yizi 138 and Beijing 553 developed lesions on their surface during storage. Typical lesions consisted of alternating light and dark brown concentric rings that were darker than the root surface. The size of the lesions was 49 × 63 mm (11 to 75 × 36 to 80 mm, n = 20) on average. The lesion spot was slightly concave. Cutting the diseased roots revealed the lesions could extend into the center of the roots, often with cavities. It smelled bitter within the necrotic tissues and was dark brown or black. The disease incidence was about 10 to 20%. A Fusarium species was consistently isolated from the diseased roots (n = 20). Mycelial plugs from a pure culture of the pathogen on potato dextrose agar were placed on the surface of disinfected sweet potato roots incubated at 25°C with 80 to 90% relative humidity and uninoculated roots were used as control. The same symptom was observed after 14 days on all roots (n = 20) inoculated with the pathogen. The same Fusarium species was consistently reisolated from all lesions. The pathogen was cultured on carnation leaf agar (CLA) for 10 days at 25°C with a 12-h photoperiod. The fungus produced two types of spores on CLA: microconidia were thin-walled, hyaline, fusiform to ovoid, generally 1- or 2-celled, and 3.1 to 9.4 × 1.3 to 2.9 μm (n = 20); macroconidia were slightly curved with blunt and rounded apical cell and notched basal cells, mostly 4- to 8-celled, and 13.3 to 36.5 × 2.3 to 3.8 μm (n = 40). On the basis of morphological characteristics, the fungal isolates were identified as Fusarium solani (Mart.) Appel & Wollenw. emend. Snyd. & Hans. (1). The genomic DNA of the pathogen cultured in potato dextrose broth for 3 days at 25°C was extracted with the CTAB method. The ITS-rDNA sequence, a fragment of the translation elongation factor 1-alpha (EF-1α) gene sequence, and the beta tubulin gene sequence was amplified using the paired primers ITS1F/ITS4(CTTGGTCATTTAGAGGAAGTAA/TCCTCCGCTTATTGA TATGC), EF-1/EF-2 (ATGGGTAAGGARGACAAGAC/GGARGTACCAGTSATCATGTT) and Bt-1/Bt-2(AACATGCGTGAGATTGTAAGT/TCTGGATGTTGTTGGGAATCC), respectively. Those sequence showed 97% homology with ITS sequence of F. solani (GenBank Accession No. AF178407), 99% homology with EF-1α sequence of F. solani (JX945169, DQ247593, and DQ247354), and 98% homology with beta tubulin gene sequence of F. solani (AB553621), respectively. The new sequences of ITS-rDNA, EF-1α, and beta tubulin were deposited in GenBank (KF255997, KF255995, and KF255996). The pathogen was identified as F. solani based on its morphological and molecular characteristics. To our knowledge, this is the first report of F. solani-induced fusarium root rot and stem canker on sweet potato storage roots in China. A rootlet root rot attributed to F. solani in China was reported previously (2). References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, Blackwell Publishing, Ames, IA, 2006. (2) Q. J. Liu et al. Acta Phytopathol. Sin. 12(3):21,1982.
Reference Key
wang2014firstplant Use this key to autocite in the manuscript while using SciMatic Manuscript Manager or Thesis Manager
Authors Wang, R-Y;Gao, B;Li, X-H;Ma, J;Chen, S-L;
Journal Plant disease
Year 2014
DOI
10.1094/PDIS-06-13-0651-PDN
URL
Keywords

Citations

No citations found. To add a citation, contact the admin at info@scimatic.org

No comments yet. Be the first to comment on this article.