A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

Clicks: 210
ID: 33908
2005
Free PDF
Article Quality & Performance Metrics
Overall Quality
Not rated
Combines reader engagement with the AI quality analysis. This article has not been analysed, so there is no overall score — reader engagement is measured and shown alongside.
AI Quality Assessment
Not analyzed
Readership in this journal
Popular

Ranked #58 of 60 articles by views in indonesian journal of biotechnology

Most read Least read

Bar heights use a square-root scale.

Mint this article as an NFT
Not yet minted

Create a permanent, verifiable on-chain record of this article on the Scimatic Network. The NFT is held in your Journament account, and you can withdraw it to your own wallet at any time.

5 SUSD one-off · no wallet required
Sign in to mint
Abstract
The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecular probe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genome and a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probe labeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect 0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with the molecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detection starter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequence GGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNA target by dot blot method. Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization
Reference Key
sumartono2005aindonesian Use this key to autocite in the manuscript while using SciMatic Manuscript Manager or Thesis Manager
Authors S. Sumartono;
Journal indonesian journal of biotechnology
Year 2005
DOI
10.22146/ijbiotech.7409
URL
https://jurnal.ugm.ac.id/ijbiotech/article/download/7409/5763
Keywords Keywords not found

Citations

No citations found. To add a citation, contact the admin at info@scimatic.org

Comments

No comments yet. Be the first to comment on this article.