identification and prevalence of grapevine fanleaf virus in khorasan-razavi vineyards
Clicks: 140
ID: 232558
2016
Article Quality & Performance Metrics
Overall Quality
Not rated
Combines reader engagement with the AI quality analysis. This
article has not been analysed, so there is no overall score —
reader engagement is measured and shown alongside.
Reader Engagement
Steady Performance
30.0
/100
140 views
43 readers
AI Quality Assessment
Not analyzed
Readership in this journal
SteadyRanked #20 of 21 articles by views in bilingualism
Most read
Least read
Bar heights use a square-root scale.
Mint this article as an NFT
Not yet mintedCreate a permanent, verifiable on-chain record of this article on the Scimatic Network. The NFT is held in your Journament account, and you can withdraw it to your own wallet at any time.
5
SUSD
one-off · no wallet required
Abstract
Introduction Grapevine fanleaf virus (GFLV) is one of the devastating viruses of grapevine cause severe crop loss in vineyards. GFLV is a member of the genus Nepovirus in the family Secoviridae. The GFLV genome consists of two positive-sense single-stranded RNAs. The genome has a poly (A) tail at the 3´ terminus and a covalently linked VPg protein at the 5´ terminus. Each genomic RNA encodes a polyprotein from which functional proteins are released by proteolytic processing by the virus-specific protease. GFLV isolates differing in the type of leaf symptoms, ranging from fanleaf, yellow mosaic, vein banding and mottle in different grapevine varieties. GFLV is specifically transmitted from grapevine to grapevine by the ectoparasitic nematode species Xiphinema index. It is also transmitted by grafting, vegetative propagation or mechanical inoculation onto herbaceous plants. GFLV has restricted natural host range, grapevine is the dominant natural host of GFLV and, however, it has been reported on several weeds in Iran. It is thought that the old Persia, especially the region located between the Caspian Sea and the Black Sea, might be the origin of GFLV. Grapevine wide cultures in Khorasan-Razavi province, northeast of Iran, but little information is available for the incidence of GFLV in this region. In the present work, we are interested in the study of the Prevalence of the Grapevine fanleaf virus in Khorasan-Razavi province.
Materials and Methods: To identify the distribution of GFLV in Khorasan-Razavi, 280 leaf samples were randomly collected during the growing season of 2011-2012. GFLV was detected in leaf samples by enzyme-linked immunosorbent assay (ELISA) using specific antibodies raised against Iranian isolate of the virus (Zakiaghl and Izadpanah 2003). Chenopodium quinoa plants were used as systemic herbaceous host for the propagation of GFLV. The carborundum dusted seedlings were inoculated by extracts of ELISA positive samples in phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990). The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV) reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT) and DetR (GGTCCAGTTTAATTGCCATCCA) specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen), then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5
Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously published GFLV isolates. The phylogenetic tree based on the coat protein gene of the four Iranian isolates and 15 other isolates, with 1000 bootstrap replicates, revealed that all the GFLV isolates were placed in two main clusters, the Iranian isolates being grouped in one distinct cluster and the other GFLV isolates in the other cluster. The Iranian cluster was sub-divided into two sub-clades, which could correspond to two distinct evolutionary lineages reflect their geographical separation.
Conclusion: Grapevine fanleaf virus is the major causal agent of the grapevine degeneration disease. It has been proposed that the origin of GFLV might be the old Persia, especially the region located between the Caspian Sea and the Black Sea. Evidence supporting this theory includes the high levels of divergence and distinct phylogenetic position of Iranian isolates. The sequencing data showed that geographical separation is an important determinant factor in the phylogenetic divergence of GFLV isolates.
| Reference Key |
gholampour2016majallah-iidentification
Use this key to autocite in the manuscript while using
SciMatic Manuscript Manager or Thesis Manager
|
|---|---|
| Authors | ;Z. Gholampour;M. Zakiaghl;B. Jafarpour;M. Mehrvar |
| Journal | bilingualism |
| Year | 2016 |
| DOI |
10.22067/jpp.v29i3.27668
|
| URL | |
| Keywords |
Citations
No citations found. To add a citation, contact the admin at info@scimatic.org
Comments
No comments yet. Be the first to comment on this article.